16S rDNA Sanger sequencing of LAB isolates

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

Identifier
Source https://data.blue-cloud.org/search-details?step=~012243B36D8DA31C8B5F037C0565007EA45A913689B
Metadata Access https://data.blue-cloud.org/api/collections/243B36D8DA31C8B5F037C0565007EA45A913689B
Provenance
Instrument AB 3730xL Genetic Analyzer; CAPILLARY
Publisher Blue-Cloud Data Discovery & Access service; ELIXIR-ENA
Publication Year 2024
OpenAccess true
Contact blue-cloud-support(at)maris.nl
Representation
Discipline Marine Science
Temporal Point 2016-01-01T00:00:00Z