Dataset - B2FIND

NCTC_3000

http://www.sanger.ac.uk/resources/downloads/bacteria/nctc/
16S rDNA Sanger sequencing of LAB isolates

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
WGS of bacteria used in a diverse Mock

A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for...

You can also access this registry using the API (see API Docs).

3 datasets found