-
CDC HAI-Seq Enterococcus species
CDC’s Division of Healthcare Quality Promotion’s BioProject for whole genome sequence data of Enterococcus spp. We have implemented a standard scheme for isolate/sample... -
A StrainAtlas of the human gut microbiome
A cultured isolate collection from a broad human population -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines.
