-
Recovery of nearly 8,000 uncultivated bacterial and archaeal genomes substant...
Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing... -
Compliance in Probiotic Products
Evaluation of compliance in Probiotic Products sold as dietary supplements in USA and Canada -
Genome sequencing project
The NBRC Whole Genome Shotgun Project aims to provide "reference genomes" of NBRC culture collection strains for identifying useful genes for taxonomic classification,... -
Live Microbial Ingredients Survey
Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization. -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This... -
Genomic Catalog of Human Bladder Bacteria
We have developed a bladder-specific bacterial reference database consisting of 1134 genomes to aid in genomic, functional, and experimental analyses of the human bladder... -
16S rDNA sequencing
The object of this study is to explore the association between maternal gut microbiota and risk of congenital heart disease in offspring, as well as the possible mechanisms... -
Reliability of species detection in 16S microbiome analysis
The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and... -
Generation_of_draft_genomes_for_supershedder_and_bacteriotherapy_bacteria
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
RNA degradation analysis reveals ribosome dynamics in complex microbiome samples
The microbiome has revealed itself as a key player in health and disease. To better understand its role, in addition to microbial diversity, it is important to understand... -
WGS of bacteria used in a diverse Mock
A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for...