-
Drakenstein12internal
This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our... -
The Epigenomic Landscape of Prokaryotes
DNA methylation is an important regulator of genome function in the eukaryotes, but it is currently unclear if the same is true in prokaryotes. While regulatory functions have... -
Lactobacillus_in_severe_early_childhood_caries
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Taxonomy and functional diversity of bacterial communities in lake under the ...
Studies on the structure and function of microbial communities spatial and temporal distribution characteristic in lakes around man-made forests are limited. Here, we used NGS... -
Live Microbial Ingredients Survey
Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization.
