-
Recovery of nearly 8,000 uncultivated bacterial and archaeal genomes substant...
Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing... -
Lactobacillus plantarum-Saccharomyces cerevisiae RNA-seq
The mono-culture and co-culture of Lactobacillus plantarum and Saccharomyces cerevisiae were applied to RNA-seq. -
A StrainAtlas of the human gut microbiome
A cultured isolate collection from a broad human population -
Drakenstein12internal
This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our... -
The Epigenomic Landscape of Prokaryotes
DNA methylation is an important regulator of genome function in the eukaryotes, but it is currently unclear if the same is true in prokaryotes. While regulatory functions have... -
Lactobacillus_in_severe_early_childhood_caries
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
Compliance in Probiotic Products
Evaluation of compliance in Probiotic Products sold as dietary supplements in USA and Canada -
The isolates from feces in Felidae
The isolates from feces in Felidae -
Lactobacillus plantarum Raw sequence reads
Trimethylamine N-oxide (TMAO), which is oxidized from trimethylamine (TMA) by hepatic flavin-containing monooxygenases (FMOs), promotes the development of atherosclerosis and is... -
Live Microbial Ingredients Survey
Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization. -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
RNA degradation analysis reveals ribosome dynamics in complex microbiome samples
The microbiome has revealed itself as a key player in health and disease. To better understand its role, in addition to microbial diversity, it is important to understand... -
WGS of bacteria used in a diverse Mock
A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for... -
Experimental Co-evolution of Saccharomyces cerevisiae and Lactobacillus plant...
Experimental co-evolution with Saccharomyces cerevisiae and Lactobacillus plantarum. -
ON-rep-seq
Despite the massive developments within culture-independent methods for detection and quantification of microorganisms during the last decade culture-based methods remain a...
