69 datasets found

Raw sequencing reads of two marine sponges native to the U.K. (Hymeniacidon perlevis, Suberties massa) at two different time points

The sunlight surface layer of the ocean is the largest contiguous biome on the planet. The photoautotrophic microbial communities in the ocean fix roughly equal amounts of CO2...

Sequence, assembly, and annotate the complete mitochondrial genome of Trimma macrophthalmus collected from Taiwan.

Disease screen of pathogens and parasites of the common shore crab Carcinus maenas

<p> This project consists of analyses of of planktonic microbial communities in a region of the North Pacific Ocean. The Subtropical Gyre consists of a clockwise swirling...

Culturable bacterial community associated with marine sponge Aplysina

In this study we have done a population genetics study, where sequencing COI gene from the host and gapA gene from the bacterial symbiont we assesed the genetic structure of the...

Raw sequences of the complete mitochondrial genome of Zalophus japonicus by Sanger sequencing

The study aims to analyze and characterize the complete mitogenome of the bait worm, Marphysa victori and reveal the phylogenetic relationship of M. victori and the other 12...

Full length of Calreticulin coding sequence of bay scallop

Cultured organisms from Bayelva Active Layer Permafrost. 16S rRNA from isolates.

This dataset was collected during the expedition 'SponGES0617' of research vessel Angeles Alvarino in 2017 to the Aviles Canyon System and the Le Danois Bank. It includes...

The aim of the study is to monitor the gene expression of the dabA gene in response to nutrient depletion and addition in the toxic diatom Pseudo-nitzschia multistriata, which...

Rechargeable microbial batteries have been proposed as one the potential applications of bio-electrochemical systems (BESs), in which a single biofilm can generate power and...

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

<P><I><B>Methanococcus maripaludis</I> strain S2</B>. This strain was first isolated from salt marsh sediment near Pawley's Island, South Carolina...

cell cycle gene

Apicomplexan parasites, such as Toxoplasma gondii, have specific adaptations that enable invasion and exit from the host cell. Owing to the phylogenetic distance between...

Eukaryotes existed exclusively as microorganisms for a minimum of 500,000 to one billion years prior to the evolution of plants, animals and fungi. Understanding the...

To prove the function of this gene