-
Genomic Catalog of Human Bladder Bacteria
We have developed a bladder-specific bacterial reference database consisting of 1134 genomes to aid in genomic, functional, and experimental analyses of the human bladder... -
Bacteriophage, phage-like element and intestinal VLP metagenomics
This study explores the use of metagenomics to study the induction profiles of bacteriophages, phage-like elements and intestinal virus-like particles (VLPs) from both in vitro... -
CVM NARMS Retail Seafood Isolates
Whole genome sequencing of foodborne pathogens isolated from retail seafood as part of the US Food and Drug Administration surveillance project for NARMS -
Human microbiome associated bacterial genomes
This project is designed to uncover antimicrobial drug leads from human symbionts. -
Enterococcus faecalis Genome sequencing
to study on the sequence characteristics of linezolid resistant Enterococcus faecalis. -
Crop Bioprotection in collaboration with NRRL Raw sequence reads
Genome sequencing of Bacillus isolates. -
Clinical evaluation of mNGS in unbiased pathogens diagnosis of UTIs
Advance the implementation of mNGS in pathogen diagnosis in clinics. -
Bacteria and yeast pathogens sequenced from human blood culture specimens
Bloodstream infection is a major cause of morbidity and mortality worldwide. Early pathogen detection and administration of appropriate antimicrobial therapy substantially... -
Vet-LIRN-Other-GU
Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria -
Enhanced detection system for hospital associated transmission (EDS-HAT)
Whole genome sequencing of bacterial pathogens is combined with machine learning and data mining of the electronic medical record to enhance outbreak detection in hospitals and... -
Major food bacterial pathogens in the united states and around the world, inc...
University of California at Davis 100K Pathogen Genome Project. Major bacterial pathogens in the United States and around the world, including Salmonella enterica, E. coli,... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Metagenomic next-generation sequence data of Suspected Infected Pancreatic Ne...
42 blood samples and 22 peri-pancreatic specimens from 42 suspected infected pancreatic necrosis patients were collected to investigate the diagnostic performance of metagenomic... -
Clinical metagenomics and metatranscriptomics for pathogen discovery
This project aims to develop DNA and RNA sequencing as tools for pathogen discovery in a clinical setting. -
SC PHL pathogens isolated from wastewater samples that are not routine Genome...
Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms. -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to... -
NIHR_Global_Health_Research_Unit_on_Genomic_Surveillance_of_Antimicrobial_Res...
This project is funded by the UK National Institute for Health Research to set up a full-fledged Global Health Research Unit (GHRU) through a grant awarded to the cGPS (Centre... -
Microbiological parameters and biochemical oxygen demand (BOD) on shore in Ja...
This dataset has no description